AlgaTerra Information System on Micro Algae - Molecular Data and Phylogeny

Molecular Phylogeny of Micro Algae in the AlgaTerra Database

AlgaTerra Information System on terrestrial and limnic Micro Algae

DNA Data in AlgaTerra

	Cyclotella meneghiniana Kütz.
	Kieselschal. Bacill., p. 50, pl. 3: fig. 68. 1844.
	[D15_036] sec. Zimmermann, J., Jahn, R. & Gemeinholzer, B. - Barcoding diatoms: evaluation of the V4 subregion on the 18S rRNA gene, including new primers and protocols 2011.

------------
	Culture Strain No: D15_036
	Locus: FR873240, 387 bp DNA linear, PLN 09-AUG-2011
	Definition: Cyclotella meneghiniana partial 18S rRNA gene, specimen voucher B 40 0040688, strain D15_036.
	Accession: FR873240
	Version: FR873240.1 GI:343178529
	Keywords: 18S rRNA
	Source: Cyclotella meneghiniana
	Organism: Cyclotella meneghiniana; Eukaryota; stramenopiles; Bacillariophyta; Coscinodiscophyceae; Thalassiosirophycidae; Thalassiosirales; Thalassiosiraceae; Cyclotella.
Reference:
	(bases 1 to 387) Zimmermann, J. (Direct Submission): Submitted (07-JUN-2011) to the INSDC. Botanic Garden and Botanical Museum Berlin-Dahlem, Freie Universitaet Berlin, Koenigin-Luise-Str. 6-8, 14195 Berlin, GERMANY
Features:
	FEATURES
	Sequence Length: 387
	Base Count:

Origin:
	001 attccagctc caatagcgta tattaaagtt gttgcagtta aaaagctcgt agttggattt 061 ctggcaggag cgtccggtct cgcactctgt gcgggaactt ggatgtctct ggccatcttt 121 ggggatatcc tgtttggcat taagttgtcg ggcaggggat acccatcgtt tactgtgaaa 181 aaattagagt gtttaaagca ggcttatgcc gttgaatata ttagcatgga ataataagat 241 aggaccctgg tactattttg ttggtttgcg cacctgggta atgattaata gagacaggcg 301 gggctattcg tattgcattg tcagaggtga aattcttgga tttctgcaag acgaactact 361 gcgaaagcat ttagcaagga tgttttc


Plain Sequence:
ATTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATTTCTGGCAGGAGCGTCCGGTCTCGCACTCTGTGCGGGAACTTGGATGTCTCTGGCCATCTTTGGGGATATCCTGTTTGGCATTAAGTTGTCGGGCAGGGGATACCCATCGTTTACTGTGAAAAAATTAGAGTGTTTAAAGCAGGCTTATGCCGTTGAATATATTAGCATGGAATAATAAGATAGGACCCTGGTACTATTTTGTTGGTTTGCGCACCTGGGTAATGATTAATAGAGACAGGCGGGGCTATTCGTATTGCATTGTCAGAGGTGAAATTCTTGGATTTCTGCAAGACGAACTACTGCGAAAGCATTTAGCAAGGATGTTTTC
	Proposed Barcode
	Zimmermann, J., Jahn, R. & Gemeinholzer, B. 2011: Barcoding diatoms: evaluation of the V4 subregion on the 18S rRNA gene, including new primers and protocols. - Org. Divers. Evol. 11(3): 173-192.
	http://www.ncbi.nlm.nih.gov/nuccore/FR873240

AlgaTerra is maintained by the Botanic Garden and Botanical Museum Berlin-Dahlem, FU Berlin, Germany.
Please contact us for any problem. Disclaimer.