AlgaTerra Information System on Micro Algae - Molecular Data and Phylogeny

Molecular Phylogeny of Micro Algae in the AlgaTerra Database

AlgaTerra Information System on terrestrial and limnic Micro Algae

DNA Data in AlgaTerra

	Nitzschia dissipata (Kütz.) Rabenh.
	Rabenh. Alg. Sachs., Dec. 95/96, p. 948. 1860.
	[D03_120] sec. Zimmermann, J., Jahn, R. & Gemeinholzer, B. - Barcoding diatoms: evaluation of the V4 subregion on the 18S rRNA gene, including new primers and protocols 2011.

------------
	Culture Strain No: D03_120
	Locus: FR873259, 373 bp, DNA, linear, PLN 09-AUG-2011
	Definition: Nitzschia dissipata partial 18S rRNA gene, specimen voucher B 40 0040710, strain D03_120.
	Accession: FR873259
	Version: FR873259.1 GI:343178548
	Keywords: 18S rRNA
	Source: Nitzschia dissipata
	Organism: Nitzschia dissipata;
Reference:
	(bases 1 to 373) Zimmermann, J. (Direct Submission): Submitted (07-JUN-2011) to the INSDC. Botanic Garden and Botanical Museum Berlin-Dahlem, Freie Universitaet Berlin, Koenigin-Luise-Str. 6-8, 14195 Berlin, GERMANY
Features:
	FEATURES
	Sequence Length: 373
	Base Count:

Origin:
	001 atagcgtata ttaaagttgt tgcagttaaa aagctcgtag ttggatttgt ggttgtcgtt 061 gtcttttcct ctctttgagg ggtattggat tagcgtcgcc atccttgggt ggaagttgtg 121 tggcattagg ttgtcgtgca ggggatgccc atcgtttact gtgaaaaaat tagagtgttc 181 aaagcaggct tatgccgttg aatatattag catggaataa taagatagga ccttggtact 241 attttgttgg tttgcgcact aaggtaatga ttaatagggt cagttggggg tattcgtatt 301 ccattgtcag aggtgaaatt cttggatttt tggaagacga actactgcga aagcatttac 361 caaggatgtt ttc


Plain Sequence:
ATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATTTGTGGTTGTCGTTGTCTTTTCCTCTCTTTGAGGGGTATTGGATTAGCGTCGCCATCCTTGGGTGGAAGTTGTGTGGCATTAGGTTGTCGTGCAGGGGATGCCCATCGTTTACTGTGAAAAAATTAGAGTGTTCAAAGCAGGCTTATGCCGTTGAATATATTAGCATGGAATAATAAGATAGGACCTTGGTACTATTTTGTTGGTTTGCGCACTAAGGTAATGATTAATAGGGTCAGTTGGGGGTATTCGTATTCCATTGTCAGAGGTGAAATTCTTGGATTTTTGGAAGACGAACTACTGCGAAAGCATTTACCAAGGATGTTTTC
	Proposed Barcode
	Zimmermann, J., Jahn, R. & Gemeinholzer, B. 2011: Barcoding diatoms: evaluation of the V4 subregion on the 18S rRNA gene, including new primers and protocols. - Org. Divers. Evol. 11(3): 173-192.
	http://www.ncbi.nlm.nih.gov/nuccore/FR873259

AlgaTerra is maintained by the Botanic Garden and Botanical Museum Berlin-Dahlem, FU Berlin, Germany.
Please contact us for any problem. Disclaimer.